Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system

Abstract

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation’s requirements.

The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens’ taxon-specific DNA detection and identification in food raw materials and foods.

Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation.

Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers – 550 nM, probe – 100 nM. The time/temperature profile of the reaction: 95 °C – 180 s (95 °C – 15 s, 57 °C – 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms.

Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens’ detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

Keywords:DNA-based methods; control over novel food; edible insects; Hermetia Illucens; cytochrome c oxidase subunit I mitochondrial gene

Funding. The research was funded by the Russian Science Foundation (project № 20-16-00083).

Conflict of interest. The authors have no conflict of interest to declare.

Contribution. Concept and design of the study – Sadykova E.O., Tyshko N.V.; collecting and processing the material – Sadykova E.O., Shestakova S.I., Trebukh M.D., Nikitin N.S.; statistical processing – Sadykova E.O.; text writing – Sadykova E.O., Tyshko N.V.; editing, approval of the final version of the article, responsibility for the integrity of all parts of the article – all authors.

Acknowledgments. The authors sincerely thank the undergraduate of the Moscow Polytechnic University Ulyana O. Ryabinina and researcher of the Federal Research Centre of Nutrition, Biotechnology and Food Safety Nikita V. Trusov, for assistance in the researches’ carrying out.

For citation: Sadykova E.O., Tyshko N.V., Nikitin N.S., Trebukh M.D., Shestakova S.I. Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system. Voprosy pitaniia [Problems of Nutrition]. 2023; 92 (1): 36–44. DOI: https://doi.org/10.33029/0042-8833-2023-92-1-36-44 (in Russian)

References

1. Tyshko N.V., Zhminchenko V.M., Nikitin N.S., Trebukh M.D., Shestakova S.I., Pashorina V.A., et al. The comprehensive studies of Hermetia illucens larvae protein’s biological value. Voprosy pitaniia [Problems of Nutrition]. 2021; 90 (5): 49–58. DOI: 10.33029/0042-8833-2021-90-5-49-58 (in Russian)

2. Sadykova E.O., Shumakova A.A., Shestakova S.I., Tyshko N.V. Nutritional and biological value of Hermetia illucens larvae biomass. Voprosy pitaniia [Problems of Nutrition]. 2021; 90 (2): 73–82. DOI: https://doi.org/10.33029/0042-8833-2021-90-2-73-82 (in Russian)

3. Salihah N.T., Hossain M.M., Lubis H., Ahmed M.U. Trends and advances in food analysis by real-time polymerase chain reaction. J Food Sci Technol. 2016; 53 (5): 2196–209. DOI: https://doi.org/10.1007/s13197-016-2205-0

4. Bell S., Butler J. First-generation forensic DNA. In: Understanding Forensic DNA. Cambridge: Cambridge University Press, 2022: 35–49. DOI: https://doi.org/10.1017/9781009043311.005

5. Bastrakov A.I., Ushakova N.A. Properties of Hermetia illucens fly larvae in artificial breeding. Evraziyskiy soyuz uchonikh [Euroasian Scientists Union]. 2014; (8): 105–7. (in Russian)

6. Hebert P.D., Ratnasingham S., De Waard J.R. Barcoding animal life: cytochrome c oxidase subunit 1 divergence, among closely related species. Proc Biol Sci. 2003; 270 (suppl 1): 96–9. DOI: https://doi.org/10.1098/rsbl.2003.0025

7. Zagon J., Rienzo V., Potkura J., Lampen A., Braeuning A. A real-time PCR method for the detection of black soldier fly (Hermetia illucens) in feedstuff. Food Control. 2018; 91: 440–8. DOI: https://doi.org/10.1016/j.foodcont.2018.04.032

8. Stahls G., Meier R., Sandrock C., Hauser M., Šašić Zorić L., Laiho E., et al. The puzzling mitochondrial phylogeography of the black soldier fly (Hermetia illucens), the commercially most important insect protein species. BMC Evol Biol. 2020; 20 (1): 60. DOI: https://doi.org/10.1186/s12862-020-01627-2

9. Khamis F.M., Ombura F.L., Akutse K.S., Subramanian S., Mohamed S.A., Fiaboe K.K.M., et al. Insights in the global genetics and gut microbiome of black soldier fly, Hermetia illucens: implications for animal feed safety control. Front Microbiol. 2020; 11: 1538. DOI: https://doi.org/10.3389/fmicb.2020.01538

10. Ferdousi L., Sultana N., Helal M.A. Momtaz N. Molecular identification and life cycle of Black Soldier fly (Hermetia illucens) in laboratory. Bangladesh J Zool. 2021; 48 (2): 429–40. DOI: https://doi.org/10.3329/bjz.v48i2.52381

11. Voronova N.V., Buga S.V., Kurchenko V.P. Sequence of cytochrome c oxidase subunit I gene in animal molecular taxonomy: principles, results and usage problems. Trudy Belorusskogo gosudarstvennogo universiteta [Proceedings of the Belarusian State University]. 2012; 7 (1–2): 22–42. (in Russian)

12. Daniso E., Melpignano P., Tulli F. An OLED-based genosensor for the detection of Hermetia illucens in feeds. Food Control. 2020; 113: 107179. DOI: https://doi.org/10.1016/j.foodcont.2020.107179

13. Garino C., Zagon J., Nesic K. Novel real-time PCR protocol for the detection of house cricket (Acheta domesticus) in feed. Anim Feed Sci Technol. 2021; 280: 115057. DOI: https://doi.org/10.1016/j.anifeedsci.2021.115057

14. Garino C., Winter R., Broll H., Winkel M., Braeuning A., Reich F., et al. Development and validation of a novel real-time PCR protocol for the detection of buffalo worm (Alphitobius diaperinus) in food. Food Control. 2022; 140: 109138. DOI: https://doi.org/10.1016/j.foodcont.2022.109138

15. Chemeris D.A., Kir’yanova O.Y., Gubaydullin I.M., Chemeris A.V. Primer design for polymerase chain reaction (brief review of computer programs and databases). Biomika [Biomics]. 2016; 8 (3): 215–8. (in Russian)

16. Garafutdinov R.R., Baymiev An.H., Maleev G.V., Alekseev Ya.I., Zubov V.S., Chemeris D.A., et al. Diversity of primers for PCR and principles of their selection. Biomika [Biomics]. 2019; 11 (1): 23–70. DOI: https://doi.org/10.31301/2221-6197.bmcs.2019-04 (in Russian)

17. Petrov D.G., Makarova E.D., Hermash N.N., Antifeev I.Е. Methods of DNA isolation and purification from cell lysates (review). Nauchnoe priborostroenie [Scientific Instrumentation]. 2019; 29 (4). 28–50. DOI: https://doi.org/10.18358/np-29-4-i2850 (in Russian)

Подобранный эмпирическим путем состав реакционной смеси представлен в табл. 3.

Оптимальную температуру отжига праймеров и зондов подбирали методом градиентной ПЦР с температурой отжига в диапазоне 51-61 °C со ступенчатым повышением на 1 °C (рис. 4), остальные температурно-временные условия устанавливали согласно инструкции ПЦР-микса. Приемлемые параметры реакции [S-образная архитектура кривой флюоресценции, минимальная величина порогового цикла, эффективность реакции (E=97%), угол наклона кривой (М=-3,4), коэффициент корреляции (R2=0,99)] наблюдались при температуре отжига 57 °C (см. рис. 4). Подобранный эмпирическим путем температурно-временной режим амплификации представлен в табл. 4.

Обеспечение качества аналитических измерений возможно при условии применения валидированных методов с установленными метрологическими характеристиками, поэтому на завершающем этапе исследований была проведена оценка специфичности метода и предела его обнаружения.

Оценка специфичности праймеров и зонда методом ПЦР-РВ в отношении ряда нецелевых таксонов показала отсутствие перекрестных реакций с насекомыми (Tenebrio molitor, Locusta migratoria, Zophobas morio), животными (Sus scrofa, Gallus gallus, Salmo salar), растениями (Solanum tuberosum, Pisum sativum L.), микроорганизмами (L. casei и L. rhamnosus) и наличие специфической амплификации с H. Illucens (табл. 5). Результаты исследования образцов пищевых продуктов - мясных (колбасные изделия), молочных (йогурт, запеканка из творога) и растительных (хлебобулочные изделия) также свидетельствовали о достаточном уровне специфичности. Таким образом, подтверждена способность разработанного метода однозначно идентифицировать H. Illucens, что свидетельствует о его высокой специфичности.

Предел обнаружения оценивали методом ПЦР-РВ с использованием образцов ДНК, выделенной из H. Illucens, полученных методом 5-кратного серийного разведения в 4-кратной повторности (табл. 6).

Приемлемость полученных результатов оценивали по углу наклона кривой (M=-3,6) коэффициенту корреляции (R2=0,99), эффективности реакции E=94%). Предел обнаружения метода составил 0,19 нг ДНК H. Illucens на реакцию. Таким образом, разработанный метод обладает высокой чувствительностью, позволяя надежно выявлять и идентифицировать целевую ДНК в образцах с низкой концентрацией ДНК H. Illucens.

Заключение

В рамках разработки методов молекулярно-генетического анализа пищевой продукции нового вида, полученной из насекомых, подобраны оптимальные методы пробоподготовки, создан и апробирован протокол моноплексного TaqMan-ПЦР-анализа на базе зонда и праймерной системы Hei-COI для обнаружения и идентификации таксон-специфичной ДНК насекомого H. Illucens в составе продовольственного сырья и пищевой продукции. Разработанный таксон-специфичный метод характеризуется высокой аналитической надежностью. Специфичность экспериментально подтверждена в исследованиях с ДНК ряда насекомых, животных, растений и микроорганизмов. Предел обнаружения метода составил 0,19 нг ДНК H. Illucens на реакцию. Валидность метода подтверждена лабораторными исследованиями, что позволяет рекомендовать его для использования в рамках надзора за обращением сырья, полученного из H. Illucens.

Литература

1. Тышко Н.В., Жминченко В.М., Никитин Н.С., Требух М.Д., Шестакова С.И., Пашорина В.А. и др. Комплексные исследования биологической ценности белка личинки Hermetia illucens // Вопросы питания. 2021. Т. 90, № 5. С. 49-58. DOI: 10.33029/0042-8833-2021-90-5-49-58

2. Садыкова Э.О., Шумакова А.А., Шестакова СИ., Тышко Н.В. Пищевая и биологическая ценность биомассы личинок Hermetia illucens // Вопросы питания. 2021. Т. 90, № 2. С. 73-82. DOI: https://doi.org/10.33029/0042-8833-2021-90-2-73-82

3. Salihah N.T., Hossain M.M., Lubis H., Ahmed M.U. Trends and advances in food analysis by real-time polymerase chain reaction // J. Food Sci. Technol. 2016. Vol. 53, N 5. P. 2196-2209. DOI: https://doi.org/10.1007/s13197-016-2205-0

4. Bell S., Butler J. First-generation forensic DNA // Understanding Forensic DNA. Cambridge : Cambridge University Press, 2022. P. 35-49. DOI: https://doi.org/10.1017/9781009043311.005

5. Бастраков А.И., Ушакова Н.А. Свойства личинок мухи Hermetia illucens при искусственном разведении // Евразийский союз ученых. 2014. № 8. C. 105-107.

6. Hebert P.D., Ratnasingham S., De Waard J.R. Barcoding animal life: cytochrome c oxidase subunit 1 divergence, among closely related species // Proc. Biol. Sci. 2003. Vol. 270, suppl. 1. P. 96-99. DOI: https://doi.org/10.1098/rsbl.2003.0025

7. Zagon J., Rienzo V., Potkura J., Lampen A., Braeuning A. A real-time PCR method for the detection of black soldier fly (Hermetia illucens) in feedstuff // Food Control. 2018. Vol. 91. P. 440-448. DOI: https://doi.org/10.1016/j.foodcont.2018.04.032

8. Stahls G., Meier R., Sandrock C., Hauser M., Šašić Zorić L., Laiho E. et al. The puzzling mitochondrial phylogeography of the black soldier fly (Hermetia illucens), the commercially most important insect protein species // BMC Evol. Biol. 2020. Vol. 20, N 1. P. 60. DOI: https://doi.org/10.1186/s12862-020-01627-2

9. Khamis F.M., Ombura F.L., Akutse K.S., Subramanian S., Mohamed S.A., Fiaboe K.K.M. et al. Insights in the global genetics and gut microbiome of black soldier fly, Hermetia illucens: implications for animal feed safety control // Front. Microbiol. 2020. Vol. 11. P. 1538. DOI: https://doi.org/10.3389/fmicb.2020.01538

10. Ferdousi L., Sultana N., Helal M.A. Momtaz N. Molecular identification and life cycle of Black Soldier fly (Hermetia illucens) in laboratory // Bangladesh J. Zool. 2021. Vol. 48, N 2. P. 429-440. DOI: https://doi.org/10.3329/bjz.v48i2.52381

11. Воронова Н.В., Буга С.В., Курченко В.П. Последовательность гена субъединицы I цитохромоксидазы с в молекулярной таксономии животных: принципы, результаты и проблемы использования // Труды Белорусского государственного университета. 2012. Т. 7, ч. 1-2. С. 22-42.

12. Daniso E., Melpignano P., Tulli F. An OLED-based genosensor for the detection of Hermetia illucens in feeds // Food Control. 2020. Vol. 113. Article ID 107179. DOI: https://doi.org/10.1016/j.foodcont.2020.107179

13. Garino C., Zagon J., Nesic K. Novel real-time PCR protocol for the detection of house cricket (Acheta domesticus) in feed // Anim. Feed Sci. Technol. 2021. Vol. 280. Article ID 115057. DOI: https://doi.org/10.1016/j.anifeedsci.2021.115057

14. Garino C., Winter R., Broll H., Winkel M., Braeuning A., Reich F. et al. Development and validation of a novel real-time PCR protocol for the detection of buffalo worm (Alphitobius diaperinus) in food // Food Control. 2022. Vol. 140. Article ID 109138. DOI: https://doi.org/10.1016/j.foodcont.2022.109138

15. Чемерис Д.А., Кирьянова О.Ю., Губайдуллин И.М., Чемерис А.В. Дизайн праймеров для полимеразной цепной реакции (краткий обзор компьютерных программ и баз данных) // Биомика. 2016. Т. 8, № 3. С. 215-238.

16. Гарафутдинов Р.Р., Баймиев Ан.Х., Малеев Г.В. Алексеев Я.И., Зубов В.В., Чемерис Д.А. и др. Разнообразие праймеров для ПЦР и принципы их подбора // Биомика. 2019. Т. 11, № 1. С. 23-70. DOI: https://doi.org/10.31301/2221-6197.bmcs.2019-04

17. Петров Д.Г., Макарова Е.Д., Гермаш Н.Н., Антифеев И.Е. Методы выделения и очистки ДНК из лизатов клеток (обзор) // Научное приборостроение. 2019. Т. 29, № 4. С. 28-50. DOI: https://doi.org/10.18358/np-29-4-i2850

All articles in our journal are distributed under the CC BY-NC-ND 4.0 (Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International)

© GEOTAR-Media Publishing Group. The use of textual and illustrative content from this publication for the training of any artificial intelligence systems - including machine learning models and neural networks - is strictly prohibited without the prior written consent of the copyright holder.

SCImago Journal & Country Rank
Scopus CiteScore
CHIEF EDITOR
CHIEF EDITOR
Viktor A. Tutelyan
Full Member of the Russian Academy of Sciences, Doctor of Medical Sciences, Professor, Scientific Director of the Federal Research Centre of Nutrition, Biotechnology and Food Safety (Moscow, Russia)

Journals of «GEOTAR-Media»