Content
1 . 2023
Physiology and biochemistry nutrition

Bioactive compounds anthocyanins as a factor in the nutritional recovery of the body’s adaptive potential after intense physical activity in the experiment: assessment of immunological and hematological indicators of adaptation

Abstract

Restoring the adaptive potential of an athlete is of paramount importance not only for the implementation of his training and competitive activities, but also for maintaining health. One of the leading place in complex recovery programs in sports is given to full-fledged optimal nutrition, which provides for meeting the body’s requirements not only in energy, macro- and micronutrients, but also in minor bioactive compounds. The use of anthocyanin-containing products is a promising strategy for the normalization of metabolic and immune disorders that develop as a result of intense physical and neuro-emotional stress not only in athletes, but also in other groups of people exposed to these factors, including military personnel undergoing training in conditions close to combat. This determines the relevance of this study.

The aim of the research was to study the effect of an anthocyanin-enriched diet on hematological profile and cellular immunity in rats after intense physical activity.

Material and methods. The experiment was carried out for 4 weeks on 4 groups of male Wistar rats with an initial body weight of ≈300 g. The motor activity of the animals of the 1st (control) and 2nd groups was limited by the standard keeping animals in the vivarium, while physically active rats of the 3rd and 4th groups received additional physical activity – training on a treadmill. Before the end of the experiment, the animals of 3rd and 4th groups were given debilitating physical activity on a treadmill (until the rats refused to continue the exercise). Rats of all 4 groups received a standard semi-synthetic diet, water ad libitum. Animals in 2nd and 4th groups were additionally fed blueberry and blackcurrant extract (30% anthocyanins) as part of the diet at a daily dose of 15 mg anthocyanins/kg body weight. Hematological parameters were determined on a Coulter ACT TM 5 diff OV hematological analyzer. Expression of CD45R, CD3, CD4, CD8a, CD161 receptors on rat peripheral blood lymphocytes was determined by direct immunofluorescent staining of whole blood cells using a panel of monoclonal antibodies conjugated with fluorescent dyes: APC, FITC, PE. The measurements were carried out on an FC-500 flow cytometer.

Results. Intense physical activity in rats of the 3rd group did not lead to a significant change in erythrocyte parameters compared with the control group. Enrichment of the diet with blueberry and black currant extract (the 2nd and the 4th groups) provided a significant (p<0.05) increase in blood content of hemoglobin (Hb) (150.7±0.9 and 154.4±2.0 vs 145.4±0.9 g/l in control), hematocrit (44.95±0.21 and 46.18±0.64 vs 43.78±0.32%) and the average content of Hb in erythrocytes (18.00±0.20 and 18.03±0.24 vs 17.35±0.24 pg). The absolute content of leukocytes and other cellular elements of the leukocyte formula, as well as leukocyte indices in rats of the experimental groups didn’t significantly differ from those of the control rats, which confirms the absence of an inflammatory process. Intense physical activity and anthocyanin enrichment of the diet didn’t have a significant effect on rat platelet parameters. Enrichment of the diet of rats of the 4th group with blueberry and black currant extract led to the activation of cellular immunity, as evidenced by a significant (p<0.01) increase in the percentage (from the total content of T-lymphocytes) of T-helpers (70.13 ±1.34 vs 63.75±0.99%) and a decrease in the relative content of cytotoxic T-lymphocytes (28.65±1.38 vs 34.71±0.95%) in comparison with those in rats of the 3rd group and at the level of the trend (р<0.1) – from the 1st group indexes (66.87±1.20 and 31.87±1.26%, accordingly). Intense physical activity led to a decrease in immunoregulatory index in rats of the 3rd group (1.86±0.07) compared with the control (2.13±0.12) (p<0.1), and in animals of the 4th group this indicator was significantly higher (2.50±0.14, p<0.05). In animals of the 3rd group a statistically significant (p<0.05) decrease in the relative content of NK cells in peripheral blood was found compared to the control. Enrichment of the diet of physically active rats with blueberry and black currant extract led to a significant (p<0.05) increase in the percentage of NK cells compared to this indicator in rats of the 3rd group (4.87±0.75 vs 2.08±0.18%) and had no significant difference with the indicator in rats of the control group (4.32±0.98%).

Conclusion. The enrichment of the rats’ diet with blueberry and blackcurrant extract containing a daily dose of 15 mg of anthocyanins per kg of body weight provides an increase in blood Hb content, hematocrit and the average content Hb in erythrocytes. It has been established that intense physical activity induces the cellular immunity suppression. The activating effect of anthocyanins on adaptive cellular immunity and NK cells, which are lymphocytes of innate immunity, was revealed. The data obtained indicate the effectiveness of the use of bioactive compounds (anthocyanins) to increase the adaptive potential of the organism.

Gastroprotective and antidepressant-like effect of plum pectin (Prunus domestica L.) under water-immobilization stress in laboratory mice

Abstract

Stress effects activate the processes of free radical oxidation in the organism, lead to hyper production of reactive radicals and oxidative stress, provoking the development of an inflammatory process in various parts of the gastrointestinal tract. Pectin polysaccharides together with the enzyme components of the endogenous antioxidant system contribute to the elimination of the imbalance between prooxidants and antioxidants in the tissues of stressed animals and have a gastroprotective and antidepressant-like effect.

The aim of the research was to evaluate the gastroprotective, antioxidant and antidepressant-like effect of plum pectin orally administered to white laboratory mice before stressful exposure.

Material and methods. In the experiment on white BALB/c mice weighing 20–25 g (90 males, 10 in each group), pectin isolated from fresh plum fruits in an artificial gastric environment was used. It was administered orally to mice 24 h before the onset of stress exposure or behavioral activity asessment. 50 animals were subjected to 5 h of water immersion stress. After this corticosterone concentration in blood plasma, and the activity of superoxide dismutase, catalase and glutathione peroxidase in the tissue supernatants of the gastrointestinal tract were determined, and the condition of the gastric mucosa was also assessed. Behavioral activity of experimental mice (n=30) was assessed in the open field and forced swimming tests.

Results. The stress effect was accompanied by an increase in plasma corticosterone concentration (more than 3 fold), in the activity of superoxide dismutase, glutathione peroxidase in the tissues of the stomach wall and small intestine (17.9–28.6%) and destructive damage in the gastric mucosa compared with the indices of intact animals. Preliminary oral administration of plum pectin to animals at a dose of 80 mg per 1 kg of body weight helped to reduce the level of corticosterone and the number of stress-induced hemorrhages on the gastric mucosa, normalized the activity of antioxidant enzymes and also decreased the immobility time of mice in the forced swimming test. Preliminary oral administration of plum pectin to animals at a dose of 80 mg per 1 kg of body weight prevented an increase in the activity of antioxidant enzymes, corticosterone in the blood and the development of stress-induced hemorrhages on the gastric mucosa, and reduced the time of immobility of mice in the forced swimming test.

Conclusion. Plum fruit pectin pre-administered into mice before stress prevents stress-induced damage in the tissues of the gastrointestinal tract, contributing to an increase in the body’s resistance to the stress factor. Plum pectin has an antioxidant, gastroprotective and antidepressant-like effect and can be used as an ingredient in functional foods that reduce the risk of inflammatory diseases of the gastrointestinal tract under stress.

Hygiene of nutrition

The modification of methodological approaches for potential hazard identification of inadvertent chemicals in food

Abstract

The existing methodological approaches for hazard identification and selection of priority hazard contaminants in foodstuff for further health risk assessment and legislation (in case of need) do not represent the reasons of inclusion inadvertent chemical substances in a number of priority for health risk assessment. The absence both of complex assessment and potential hazard categories of contaminants do not allow to assess the urgency of health risk assessment. Thus, it’s advisable to expand the existing methodological approaches with the criteria of selection of hazard inadvertent chemical substances in food. The criteria allow for an integral assessment and further categorizing for health risk assessment and legislation.

The aim of the research was to develop the methodological approaches to selection of priority inadvertent chemical substances in foodstuff for risk analysis and legislation based on the integral assessment results.

Material and methods. Various methods of chemical analysis were applied for detection of potentially hazard chemical substances in foodstuff. The further hazard identification and selection of priority chemical substances has been based on suggested criteria and categories that complete existing methodology. The approbation of methodological approaches to integral assessment and categorizing has been carried out on milk.

Results and discussion. The potential hazard identification of inadvertent chemicals has been carried out using the complex of selection criteria. It was suggested to apply scores for calculation of integral score for further categorizing and selection of priority chemical substances (taking into account substances’ toxicity class and possibility of migration during cooking or formation during technological process, and from packing, and from food raw materials). 5 hazard chemicals in milk (2-furanmethanol, thallium, mevinphos, sulfotep, mephospholane) were defined as priority category as the result of approbation.

Conclusion. Integral assessment and categorizing of potential hazard of inadvertent chemicals in food applying basic and additional criteria taking into account natural content of the substances and their possibility of migration in food allow to assess the priority of health risk assessment and further hygienic legislation of the substances (in case if the risk level is inappropriate). During the approbation on the example of milk, 5 unintended substances that had potential hazard category I (high priority) were recommended for further risk assessment.

Monitoring methods for novel insect-derived food: the PCR protocol for the detection and identification of Hermetia Illucens insects based on the HEI-COI probe and primer system

Abstract

Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation’s requirements.

The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens’ taxon-specific DNA detection and identification in food raw materials and foods.

Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation.

Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers – 550 nM, probe – 100 nM. The time/temperature profile of the reaction: 95 °C – 180 s (95 °C – 15 s, 57 °C – 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms.

Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens’ detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.

The reasons for the formation of tolerance to food antigens

Abstract

One of the main issues of the peculiarities of the immune reactions of the gastrointestinal tract is the mechanisms of ensuring tolerance to food antigens. Concentrations of antibodies to food antigens actually reflect the state of the intestinal mucosa barrier function, and the degree of penetration of antigens into the blood determines the level of immune response to them.

The aim of the study was to determine the risk criteria for violation of tolerance to food antigens.

Material and methods. The study included the results of a survey and examination of 1334 adults living in the north of the European part of the Russian Federation, including 1100 born in the North, of which 970 were women and 364 were men. The average age of the respondents was 45.5±1.0 years. The comparison group consisted of 344 patients with pathology of the gastrointestinal tract who applied to the medical company “Biocor”. The content of immunoglobulins (Ig) G to food antigens, total IgA, cytokines (tumor necrosis factor α, interleukin-6, interleukin-4) in blood serum were determined by enzyme immunoassay.

Results. Rural residents often (more than 28%) have elevated concentrations of IgG to potato, river fish, wheat and rye antigens. Urban residents have the most pronounced decrease in tolerance to food antigens of chicken, cod, beef and pork. In healthy individuals, elevated (>100 ME/ml) concentrations of antibodies to meat products are recorded in the range of 11.3–13.9%, to dairy antigens – 11.5–14.1%, cereals – 11.9–13.4%. Slightly less frequently, elevated concentrations of antibodies to fish antigens (7.5–10.1%), vegetables (3.8–7.0%) and fruits (4.9–6.5%) are detected. In inflammatory and oncological diseases of the gastrointestinal tract, the content of antibodies to food antigens increases sharply. On average, the frequency of impaired tolerance to food antigens in patients is 2.7–6.1 times higher than in healthy individuals.

Conclusion. Violation of tolerance to food antigens is associated with an increase in blood pro-inflammatory cytokines, mainly interleukin-6. In practically healthy individuals, a decrease in tolerance to food antigens is associated with a deficiency of blood IgA. The risk criteria for violation of the diet or consumption of low-quality foods may be an increase in the frequency of detection of elevated concentrations of antibodies to meat products in 14.6±3.0%, fish – 10.7±2.3%, cereals – 13.7±1.6%, dairy products – 14.8±1.5%, vegetables – 7.8±2.4% and fruits – 6.9±5.8%.

Associations between dietary factors and periodontal status among 12-year-old children in Arkhangelsk region

Abstract

Nutrition is an important determinant of human health particularly in childhood since dietary habits and metabolic patterns are formed during this period of life. Certain nutritional factors may increase the risk for periodontal diseases (PD). Considering the associations between periodontal health and cardiovascular diseases, studies on the associations between nutritional factors and periodontal diseases are of particular importance.

The aim of the research was to study the patterns of consumption of certain foods associated with oral health according to the World Health Organization (WHO) and to assess the associations between these factors and PD among 12-year-old children in Arkhangelsk region of Russian Federation.

Material and methods. In total, 1162 12-year-old children from 7 urban and 5 rural settings of Arkhangelsk region participated in a cross-sectional study. Dental status was assessed as recommended by the WHO (2013). To assess the periodontal status of a child, a communal periodontal index was used, which included 2 indicators: the presence of bleeding during probing and calculus. A WHO-developed questionnaire was used to study nutritional patterns related to oral health. Associations between socio-demographic factors and patterns of consumption of selected food items were assessed using Person’s chi-squared tests. Associations between periodontal disease, bleeding, calculus, and nutritional factors were studied by multivariable logistic regression. Relationships between the number of affected sextans and frequency of consumption of selected foods was assessed using multivariable Poisson regression models.

Results. More frequent consumption of sweet carbonated drinks was associated with male sex, rural living, and low educational levels of both parents. Higher levels of education for both mother and father were associated with more frequent consumption of fresh fruit (p=0.011 and p=0.002). The prevalence of dental calculus and the number of affected sextants with calculus were inversely related to the frequency of fresh fruit consumption (p=0.012 and p<0.001, respectively). The number of sextants with calculus and PD in general were inversely associated with the frequency of consumption of homemade jam and honey (p=0.036 and p=0.043, respectively).

Conclusion. The frequency of consumption of the foods affecting oral health was significantly associated with socio-demographic factors in Arkhangelsk region. Daily consumption of fresh fruits was associated with lower prevalence of calculus. The lowest number of affected sextants with bleeding, calculus, and PD was revealed when homemade jams or honey was consumed at least once a week, but less than every day.

Nutrition and adipose tissue distribution in low cardiovascular risk individuals, depending on the central obesity

Abstract

The low cardiovascular risk group according to SCORE in relation to the clinical and laboratory characteristics of patients is very heterogeneous, which leads to the presence of a residual risk of cardiovascular events. This category may include individuals with a family history of cardiovascular disease at a young age, with abdominal obesity (AO), endothelial dysfunction, and high levels of triglyceride-rich lipoproteins. In this regard, an active search is underway for new metabolic markers within the low cardiovascular risk group.

The purpose of the study was to compare the nutrition, the adipose tissue distribution in low cardiovascular risk individuals, depending on the AO.

Material and methods. The study included 86 healthy low risk (SCORE<1%) patients (mean age 42.6±2 years), who were divided into 2 groups: with AO [waist circumference (WC) ≥94 cm in men and ≥80 cm in women] – 44 patients (32% of men) and without AO – 42 patients (38% of men). The body composition was carried out using the bioimpedance analyzer. The distribution of ectopic fat deposits in the liver, pancreas and epicardial region was studied using ultrasound methods. A frequency questionnaire (Diet Risk Score) was used to assess nutrition.

Results. In low risk patients with AO, signs of unhealthy diet are statistically significantly more common (in 52 in the main group vs 2% in the control group, p<0.01), ectopic deposition of adipose tissue in the liver (53 vs 9%, p<0.001), pancreas (56% in the main group, absent in the control group, p<0.001), epicardia l region (the epicardial fat thickness median is 4.24 mm in the main group vs 2.15 mm in the control group) compared with a control group.

Conclusion. The low cardiovascular risk group is very heterogeneous. One of the markers of heterogeneity is central obesity – a marker of unhealthy diet, subclinical ectopic fat deposition and hypertriglyceridemia. Patients with AO of the low cardiovascular risk group require a more thorough examination with the obligatory determination of waist circumference, ultrasound assessment of the liver and pancreas parenchyma, and determination of the epicardial fat thickness. Using a short nutrition questionnaire allows you to quickly identify signs of unhealthy diet and discuss them with the patient.

Influence of environmental factors and polymorphic loci rs6580502 of the SPINK1 gene, rs10273639 of the PRSS1 gene, rs213950 of the CFTR gene on the risk of developing acute alcoholic-alimentary pancreatitis

Abstract

The study of genetic and environmental factors on the risk of acute alcoholic-alimentary pancreatitis (AАAР) is especially relevant to interpret individual links of pathogenesis, to reduce the incidence by eliminating the impact of harmful factors and improve the quality of life of the population through the introduction of optimal nutrition, and a healthy lifestyle, which is especially important for carriers of risk genotypes.

The aim of the research was to study the influence of environmental factors and polymorphic loci rs6580502 of the SPINK1 gene, rs10273639 of the PRSS1 gene, rs213950 of the CFTR gene on the risk of АAР.

Material and methods. Blood DNA samples obtained from 547 patients with AАAР and 573 healthy individuals were used as the material for the study. The groups were comparable by sex and age. All participants were assessed qualitatively and quantitatively for risk factors, smoking and alcohol consumption, the frequency, quantity and regularity of intake of various types of foods, as well as the size and number of portions eaten. Genomic DNA was isolated by the standard phenol-chloroform extraction method, multiplex genotyping of SNPs was performed on a MALDI-TOF MassARRAY-4 genetic analyzer.

Results. It was found that the T/T genotype (p=0.0012) of the rs6580502 SPINK1 was associated with an increased risk of AAAP, and the T allele (p=0.0001) and C/T and T/T genotypes (p=0.0001) of the rs10273639 PRSS1, A allele (p=0.01) and A/G and A/A genotypes (p=0.0006) of the rs213950 CFTR were associated with an decreased risk of the disease. The revealed effects of polymorphic loci of candidate genes were enhanced by the effect of alcohol consumption. The risk of AAAP was reduced by fat intake of less than 89 g per day in carriers of the A/G-A/A CFTR genotypes (rs213950), consumption of fresh vegetables and fruits of more than 27 g per day in carriers of the T/C-T/T PRSS1 genotypes (rs10273639), protein intake of more 84 g per day in carriers of T/C-T/T PRSS1 rs10273639 and A/G-A/A CFTR rs213950. The most significant models of gene-environment interactions included risk factors: deficiency in the diet of protein, fresh vegetables and fruits, smoking, and polymorphic variants of the PRSS1 (rs10273639) and SPINK (rs6580502) genes.

Conclusion. In order to prevent the development of AAAP, carriers of risk genotypes of candidate genes need not only to exclude or significantly reduce alcohol consumption (in terms of volume, frequency and duration); but also carriers of the A/G-A/A CFTR genotypes (rs213950) need to balance the diet by reducing fat intake to less than 89 g per day and increasing protein intake to more than 84 g per day; carriers of the T/C-T/T PRSS1 (rs10273639) genotypes should increase their intake of fresh vegetables and fruits over 27 g/day and protein over 84 g/day.

Micronutrients in nutrition

Polyphenols as promising bioactive compounds

Abstract

Polyphenols are diverse and widespread bioactive plant-based compounds. These compounds are found in various foods such as berries, fruits, vegetables, cereals, nuts, coffee, cacao, spices, seeds. They are divided into phenolic acids, stilbenes, flavonoids, lignans depending on their molecular structure. They attract the attention of researchers due to wide range of biological effects on human body.

The purpose of this work was to analyze modern scientific publications on the biological effects of polyphenols.

Material and methods. The review is based on publications presented in the PubMed, Google Scholar, ResearchGate, Elsevier, eLIBRARY, Cyberleninka databases using “polyphenols”, “flavonoids”, “resveratrol”, “quercetin”, “catechins” as key words. Preference was given to original researches over the past 10 years published in refereed journals.

Results. Oxidative stress, chronic inflammation, microbiome disorders, insulin resistance, excessive protein glycation, and genotoxic effects are at the heart of the pathogenesis of many diseases, including those associated with age. A large amount of material has been accumulated on the antioxidant, anticarcinogenic, epigenetic, metabolic, geroprotective, anti-inflammatory and antiviral effects of polyphenols. This gives reasons to consider polyphenols as very promising micronutrients, which inclusion in the diet can reduce the risk of developing cardiovascular, oncological, neurodegenerative diseases, diabetes mellitus, obesity, metabolic syndrome, premature aging, that is, the main causes of death, a decrease in the duration and quality of life of a modern person.

Conclusion. Expanding the range of products enriched with polyphenols with their high bioavailability is a promising area of scientific research and development of production in order to prevent socially significant age-associated diseases.

Interaction assessment of polysaccharides and minor bioactive compounds in functional food ingredients of plant origin

Abstract

At present, the scientific based view of creation enriched, specialized and functional products based on bioactive compounds (BAC) of plant origin has been formed. Interactions between polysaccharides (hydrocolloids), macronutrients of the food system and minor BAC are a determining factor in their bioavailability and should be taken into account when developing formulations and evaluated accordingly.

The objective of the research was to consider the theoretical aspects of the interaction of polysaccharides and minor BAC in functional food ingredients of plant origin, as well as to provide an overview of currently available methods for their evaluation.

Material and methods. The search and analysis of publications were carried out using the eLIBRARY, PubMed, Scopus, Web of Science databases, mainly in the last 10 years.

Results. The main interaction mechanisms of the polysaccharides with minor BAC were determined using the example of the components of the polyphenol complex (flavonoids), ecdysteroids. These include: adsorption, the formation of an “inclusion complex”, hydrogen bonding between OH-groups. The interaction of BAC with other macromolecules can occur with their significant modification as a result of the formation of complexes and cause a decrease in biological activity. The assessment of the degree of interaction of hydrocolloids with minor BAC can be carried out using both in vitro and in vivo methods. Most of these studies are carried out in vitro, do not take into account many factors that affect the bioavailability of BAC. Thus, it can be noted that, despite significant progress in the development of functional food ingredients based on medicinal plant materials, the studies of the interactions of BAC with polysaccharides using relevant models are not currently carried out to the extent necessary.

Conclusion. Based on the data presented in the review, it can be concluded that plant polysaccharides (hydrocolloids) have a significant effect on the biological activity and availability of minor BAC (polyphenols, ecdysteroids). As an optimal technique for a preliminary assessment of the degree of interaction, it is recommended to use a model that includes the main enzymatic systems, which allows you to accurately reproduce the processes occurring in the gastrointestinal tract; at the final stage, it is necessary to confirm the biological activity in vivo.

Proteases for obtaining of food protein hydrolysates from proteinaceous by-products

Abstract

Due to the increasing shortage of food protein in the world, the most effective and complete use of proteinaceous substrates is an urgent task. The most promising way to utilize secondary protein-containing raw materials is to increase its nutritional value through enzymatic hydrolysis. The use of protein hydrolysates obtained from protein-containing by-products has great potential in various areas of the food industry, as well as in the production of foods for medical and special dietary uses.

The aim of the research was to propose optimal methods for processing protein substrates to obtain hydrolysates with desired properties, taking into account the characteristics of the main types of proteinaceous by-products and the specificity of proteases used.

Material and methods. We used the data contained in PubMed, WoS, Scopus, and eLIBRARY.RU databases, which meet the requirements of scientific reliability and completeness.

Results. Collagen-containing wastes from the meat, poultry and fish processing industries, whey, soy protein and gluten are the main types of protein-containing by-products successfully used to produce food and functional hydrolysates. The molecular structure, basic biological and physico-chemical properties of collagen, whey proteins, various protein fractions of wheat gluten and soy protein are described. The expediency of enzymatic treatment of protein-containing by-products using proteases is shown to reduce antigenicity and eliminate anti-nutritional properties, improve nutritional, functional, organoleptic and bioactive properties for subsequent use in food production, including those for medical and special dietary uses. Information is presented on the classification of proteolytic enzymes, their main properties, and the effectiveness of their use in the processing of various types of proteinaceous by-products.

Conclusion. Based on the literature data analysis, the most promising methods for obtaining food protein hydrolysates from secondary protein-containing raw materials are proposed, including pretreatment of substrates and the selection of proteolytic enzymes with a certain specificity.

Anniversary

Aleksander K. Baturin (to the 75th anniversary of the birth)

Abstract

Anatoly A. Vorobyov 05.02.1923–23.03.2006 (to the 100th anniversary of the birth)

Abstract

All articles in our journal are distributed under the CC BY-NC-ND 4.0 (Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International)

© GEOTAR-Media Publishing Group. The use of textual and illustrative content from this publication for the training of any artificial intelligence systems - including machine learning models and neural networks - is strictly prohibited without the prior written consent of the copyright holder.

SCImago Journal & Country Rank
Scopus CiteScore
CHIEF EDITOR
CHIEF EDITOR
Viktor A. Tutelyan
Full Member of the Russian Academy of Sciences, Doctor of Medical Sciences, Professor, Scientific Director of the Federal Research Centre of Nutrition, Biotechnology and Food Safety (Moscow, Russia)

Journals of «GEOTAR-Media»